Infrequent Mutations of the p53 Gene in Pulmonary Carcinoid Tumors
ثبت نشده
چکیده
Archival specimens of 25 pulmonary carcinoids including 15 cases of typical carcinoid, 9 atypical carcinoids, and 1 large-cell nenroendocrine carcinoma were analyzed for mutations in exons 5 to 8 of the p53 gene. Mutations were identified in 4 tumors, including 3 out of 15 (20%) typical carcinoids and the single large-cell neuroendocrine carcinoma, but none of the atypical carcinomas showed a mutation. The mutations were acquired during tumor development since they were not present in the corresponding nontumorous tissue. All mutations in the typical carcinoids, a tumor type without epidemiologicai link to cigarette smoking, were G to A transitions. The level of p53 protein was investigated by immunohistochemistry with the polyclonal antibody CM-1. None of the pulmonary carcinoids investigated showed a positive reaction, despite the presence of missense mutations in two cases. Negative staining of carcinoids with mutations was also observed with the monoclonai antibodies pAbl801 and DO-1. Our data suggest that point mutations of the p53 gene are infrequent in pulmonary carcinoids thus contrasting the findings in other histological types of lung cancer, in particular small-cell lung cancer. Moreover, negative immunostaining for p53 is no indicator for the absence of p53 missense mutations in typical carcinoids. 14). The level of the p53 protein is regulated by rapid protein turnover. The amounts present in normal cells are below the sensitivity of conventional immunohistochemical detection systems (15). However, in many tumor cells p53 has a prolonged half-life and thus accumulates to levels that permit detection by IHC with several antibodies that recognize both wild-type and mutant p53 protein (16, 17). Sequence analysis of the p53 gene in tumors with elevated levels of p53 protein has shown point mutations resulting in amino-acid substitutions at evolutionary conserved sites of the protein (18, 19). Consequently, detection of accumulation of p53 protein by IHC has been proposed as a way of identifying mutations in the p53 gene (18, 19). However, because some types of p53 mutation do not result in accumulation of p53 protein, absence of a positive IHC reaction does not conclusively indicate the presence of a wild-type p53 gene (20). In order to determine the frequency and type of p53 gene mutations in pulmonary carcinoids, archival samples from 25 patients were analyzed by direct sequencing. Furthermore, accumulation of p53 protein was investigated by IHC to resolve its value as an indicator for p53 gene mutations in this tumor type. I N T R O D U C T I O N Pulmonary carcinoids together with S C L C 4 are regarded as bronchiopulmonary NE neoplasms since they have morphological and functional features in common with their putative progenitors, the pulmonary NE cells (1, 2). SCLC is a highly malignant disease marked by rapid and dissiminated tumor growth in the majority of patients (3). Pulmonary carcinoids, however, show a diverse clinical behavior ranging from dormant tumor nodules to highly malignant cancers. A classification based on histopathological criteria has evolved that defines tumor types that have similar morphological and clinical properties (4, 5); however, auxiliary criteria are still wanted. Investigation of the genetic abnormalities in pulmonary carcinoids may reveal attributes that are helpful for their classification and improve the reliability of prognosis. The gene that encodes the nuclear phosphoprotein p53 is commonly mutated in various human cancers (6). Somatic mutations of the p53 gene are frequent in SCLC (7-9) and the major histological types of NSCLC (10, 11). The mutational spectrum in these tumors is dominated by G to T transversions and thus distinct from that of most other tumors (8, 11). Because this type of base substitution is induced by some carcinogens in tobacco smoke the unusual mutational pattern may reflect the genotoxic action of this risk factor (12). Mutations of the p53 gene abrogate the tumor suppressing activity of the wild-type gene that encodes a cell cycle regulatory protein (13, Received 3/16/93; accepted 9/21/93. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1This work was supported by grants from the European Community, contract B17:002c, and the Deutsche Forschungsgemeinschaft, SFB 207 F10. 2 Present address: Institut fOr Humangenetik, Universit~t Essen, Hufelandstr. 55, W-45122 Essen, Germany. 3 To whom requests for reprints should be addressed, at Institut fiir Pathologic, Technische Universit~t Miinchen, lsmaningerStr. 22, W-8000 Miinchen, Germany. 4 The abbreviations used are:SCLC, small cell lung cancer; NE, neuroendocrine; NSCLC, non-small cell lung cancer; IHC, immunohistochemistry; PCR, polymerase chain reaction; TBS, Tris-buffered saline. M A T E R I A L S AND M E T H O D S Tissue Samples. The tissue samples used in this study were from patients who were admitted to the Department of Thoracic Surgery at the Technical University of Munich during 1981 to 1989. Tumor tissue was excised at the time of fiberoptic biopsy or operation, fixed in formalin, and embedded in paraffin wax. Paraffin blocks were drawn from the files of the Department of Pathology and reclassified histologically (4, 5). Of a total of 25 cases, 15 were typical carcinoids, 9 were atypical carcinoids, and 1 case was a large-cell NE carcinoma. Tumor size was defined as the maximum diameter of the tumor, N and M staging was performed according to standard criteria for NSCLC (3). To assess the sensitivity of our IHC system, 15 cases of SCLC drawn from the same archive and analyzed in a previous study (9) were included in the IHC analysis. Sequence Analysis. Exons 5, 7, and 8 of the p53 gene were investigated by direct sequencing as described previously (9). In addition, exon 6 was analyzed in this study. In brief, tumor tissue was scratched off from a 5-~m section under microscopic control, dewaxed, resuspended in sterile water, and heat denatured. DNA for direct sequencing was synthesized by two successive rounds of PCR using nested primers. The sequences of the primers for PCR of exon 6 were: left external, GGTTGCCCAGGGTCCCCAGG; right external, CACCCTTAACCCCTCCTCCC; left intemal, AGGCCTCTGATFCCTCACTG; right internal, CTCCCAGAGACCCCAGTTGC (all 5' to 3'). Mutations were confirmed by additional separate PCR and direct sequencing. Whenever feasible, an additional confirmation of mutant sequences was performed by restriction enzyme digestion of the mutation bearing PCR product as previously described (9). Immunohistochemistry. The polyclonal anti-p53 antibody CM-1 (Medac, Hamburg, Germany) was used for immunohistochemical detection of p53 protein in formalin-fixed, paraffin-embedded tissue sections (17, 21). For proteolytic pretreatment, tissue was incubated with Pronase E (Merck, Darmstadt, Germany) 0.1% (w/v) in TBS buffer (145 mM NaC1-20 m~a Tris, pH 7.6) at 37~ for 2 rain. To reduce nonspecific background staining, sections were incubated with normal goat serum (Dako, Hamburg, Germany) 1:5 in TBS followed by a second blocking step with 1% bovine serum albumin (Sigma, Deisenhofen, Germany). Sections were incubated with primary antibody diluted 1:300 in TBS for 90 min at room temperature. Preimmune rabbit serum was used as a negative control. Localization of the primary antibody was achieved by subsequent incubation with a biotinylated goat-anti-rabbit anti-
منابع مشابه
Infrequent mutations of the p53 gene in pulmonary carcinoid tumors.
Archival specimens of 25 pulmonary carcinoids including 15 cases of typical carcinoid, 9 atypical carcinoids, and 1 large-cell neuroendocrine carcinoma were analyzed for mutations in exons 5 to 8 of the p53 gene. Mutations were identified in 4 tumors, including 3 out of 15 (20%) typical carcinoids and the single large-cell neuroendocrine carcinoma, but none of the atypical carcinomas showed a m...
متن کاملCushing’s syndrome associated with typical, peripheral pulmonary carcinoid tumor and N2 lymph node metastasis: case report
Background: The bronchopulmonary carcinoid tumor accounts for 1-2% of all adult malignancies of the lung and 20-30% of all carcinoid tumors. Cushing’s syndrome is the result of chronic exposure to increased concentration of exogenous or endo-genus cortisol hormone, and it is generally associated with central obesity, metabolic syndrome, and hypertension. Treatment is based on decreasing cortiso...
متن کاملشناسایی جهش در اگزونهای پنج و شش ژن P53 در زنان مبتلا به سرطان پستان آذربایجان شرقی
Background and Objectives: Breast cancer (BC) is the most common invasive malignancy affecting women worldwide. The tumor-suppressor P53 gene (P53) is frequently mutated in breast tumors. To use P53 as a target for therapy, it is important to accurately assess p53 mutation status in tumor samples. Materials and Methods: A total of 102 tumor samples were collected from breast cancer patients ref...
متن کاملMutations of p53 Gene in Skin Cancers: a Case Control Study
Background: The most frequently mutated tumor suppressor gene found in human cancer is p53. In a normal situation, p53 is activated upon the induction of DNA damage to either arrest the cell cycle or to induce apoptosis. However, when mutated, p53 is no longer able to properly accomplish these functions. The aim of this study was to investigate the expression of p53 gene in cases of skin cancer...
متن کاملتعیین جهش در اگزون 8 ژن p53 در بیماران مبتلا به تومور مغزی از نوع آستروسایتوما
Background: Most studies have shown that there are association between the development and malignancy of brain tumors and tumor suppressor genes and oncogenes. The aim of this project was to investigate the P53 gene mutations in exon 8 in patients with astrocytoma type’s brain tumor. Methods: In this present survey, The DNA isolation from 30 samples of brain tissue was done by phenol-c...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
دوره شماره
صفحات -
تاریخ انتشار 2007